Stem-loop sequence ata-MIR167e

AccessionMI0031656 (change log)
DescriptionAegilops tauschii miR167e stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

1 open access papers mention ata-MIR167e
(12 sentences)

Stem-loop
   --a     c      a      --             uccga      aa      aaa     uu 
5'    gggaa gaguga gcugcc  agcaugaucuagc     gugauc  acaaga   gcuug  g
      ||||| |||||| ||||||  |||||||||||||     ||||||  ||||||   |||||   
3'    cccuu uucacu cgacgg  ucguacuggaucg     uacugg  uguucu   cgaac  a
   ccg     c      c      cg             uuccg      --      ---     uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 392778390-392778514 [-]
intergenic
Database links

Mature sequence ata-miR167e-5p

Accession MIMAT0037108
Sequence

11 - 

ugaagcugccagcaugaucua

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR167e-3p

Accession MIMAT0037109
Sequence

93 - 

ggucaugcugcggcagccucacu

 - 115

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).