Stem-loop sequence ata-MIR2275a

AccessionMI0031657 (change log)
DescriptionAegilops tauschii miR2275a stem-loop
Gene family MIPF0000797; MIR2275
Stem-loop
   gc            -    c                   a   --   cu 
5'   acugaaagugag uguu gaggaaagcaaacuggaaa auc  cau  c
     |||||||||||| |||| ||||||||||||||||||| |||  |||   
3'   uggcuuuuacuc auaa cucuuuuuguuugaccuuu uag  gug  a
   ga            u    c                   g   uc   aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr1: 471468794-471468892 [+]
intergenic
Database links

Mature sequence ata-miR2275a-5p

Accession MIMAT0037110
Sequence

11 - 

ugaguguucgaggaaagcaa

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR2275a-3p

Accession MIMAT0037111
Sequence

68 - 

uuuguuuuucuccaauaucuca

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).