Stem-loop sequence ata-MIR156c

AccessionMI0031662 (change log)
DescriptionAegilops tauschii miR156c stem-loop
Gene family MIPF0000008; MIR156
Literature search

1 open access papers mention ata-MIR156c
(37 sentences)

Stem-loop
   ----   c  gc         -    -         a      ggcgg         cgc 
5'     gcg gc  ggugacaga agag agugagcac cggccg     gacggcacc   c
       ||| ||  ||||||||| |||| ||||||||| ||||||     |||||||||    
3'     cgu cg  ccacugucu ucuc ucacucgug gccggc     cugccgugg   g
   ucuu   -  -a         a    g         c      ----a         uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 375901341-375901450 [-]
intergenic
Database links

Mature sequence ata-miR156c-5p

Accession MIMAT0037118
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR156c-3p

Accession MIMAT0037119
Sequence

79 - 

gcucacugcucuaucugucacc

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).