Stem-loop sequence ata-MIR2275b

AccessionMI0031665 (change log)
DescriptionAegilops tauschii miR2275b stem-loop
Gene family MIPF0000797; MIR2275
Stem-loop
   --      a      -               a a    -a      gcu 
5'   acugaa gugaga guuggaggaaaacaa c gauc  uggcua   a
     |||||| |||||| ||||||||||||||| | ||||  ||||||    
3'   uggcuu cacucu uaaccuccuuuuguu g cuag  acuggu   a
   gu      c      a               c a    cc      gcu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 65654016-65654111 [-]
intergenic
Database links

Mature sequence ata-miR2275b-5p

Accession MIMAT0037124
Sequence

11 - 

agaguuggaggaaaacaaaca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR2275b-3p

Accession MIMAT0037125
Sequence

65 - 

cuuguuuuccuccaauaucuca

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).