Stem-loop sequence ata-MIR9672

AccessionMI0031667 (change log)
DescriptionAegilops tauschii miR9672 stem-loop
Gene family MIPF0001942; MIR9672
Stem-loop
         gc                              ugaagacgaugcuuaauggcc 
5' gugaag  gaugcuuaaugacagucgugguguccuagg                     a
   ||||||  ||||||||||||||||||||||||||||||                      
3' cacuuc  cuacgaauuacugucagcaccauaggaucu                     g
         ua                              ucucgguccgcugacagaugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 263653904-263654023 [-]
intergenic
Database links

Mature sequence ata-miR9672-5p

Accession MIMAT0037128
Sequence

13 - 

cuuaaugacagucgugguguc

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9672-3p

Accession MIMAT0037129
Sequence

90 - 

uaccacgacugucauuaagca

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).