Stem-loop sequence ata-MIR5168

AccessionMI0031668 (change log)
DescriptionAegilops tauschii miR5168 stem-loop
Gene family MIPF0000004; MIR166
Stem-loop
   a   a              uu         a     u   ---      --        -   g 
5'  guu gguuaaggggguug  gucugguuc agguc cca   cauaca  ucauauac aug a
    ||| ||||||||||||||  ||||||||| ||||| |||   ||||||  |||||||| ||| g
3'  cga ccaauuucccuaac  cggaccagg ucuag ggu   guaugu  gguauaug uac a
   a   -              uu         c     u   uua      ua        g   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 243800257-243800380 [+]
intergenic
Database links

Mature sequence ata-miR5168-5p

Accession MIMAT0037130
Sequence

14 - 

ggguuguugucugguucaagg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5168-3p

Accession MIMAT0037131
Sequence

94 - 

ucggaccaggcuucaaucccu

 - 114

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).