Stem-loop sequence ata-MIR156b

AccessionMI0031669 (change log)
DescriptionAegilops tauschii miR156b stem-loop
Gene family MIPF0000008; MIR156
Literature search

1 open access papers mention ata-MIR156b
(37 sentences)

Stem-loop
   --ag    a          -      -              gccu   uu      ugaauuaa 
5'     gugg ggcugacaga agagag ugagcacacauggu    uuc  gcaugg        u
       |||| |||||||||| |||||| ||||||||||||||    |||  ||||||         
3'     uauu ccgacugucu ucucuu acucguguguaucg    aag  cguacu        g
   ucaa    a          c      u              ----   uu      ugaagagg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 66945650-66945771 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR156b
ata-MIR156bchr3: 66945650-66945771 [-]
ata-MIR156achr3: 66945233-66945340 [-]
Database links

Mature sequence ata-miR156b-5p

Accession MIMAT0037132
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR156b-3p

Accession MIMAT0037133
Sequence

91 - 

gcucauuucucucucugucagc

 - 112

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).