Stem-loop sequence ata-MIR172a

AccessionMI0031670 (change log)
DescriptionAegilops tauschii miR172a stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention ata-MIR172a
(2 sentences)

Stem-loop
   --  u             c           a   - -    ------cc      -  auccu     u      ca 
5'   gu ugcgggcgcggca caucaagauuc cau c cauc        auccag gc     ucggu cguuuc  a
     || ||||||||||||| ||||||||||| ||| | ||||        |||||| ||     ||||| ||||||   
3'   ca acgccugcgucgu guaguucuaag gua g guag        uagguu cg     agcua gcaaag  a
   aa  c             a           a   c u    auauaaca      g  -caac     -      ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 7396218-7396360 [+]
intergenic
Database links

Mature sequence ata-miR172a-5p

Accession MIMAT0037134
Sequence

11 - 

gcggcaccaucaagauucaca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR172a-3p

Accession MIMAT0037135
Sequence

113 - 

agaaucuugaugaugcugcgu

 - 133

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).