Stem-loop sequence ata-MIR169c

AccessionMI0031671 (change log)
DescriptionAegilops tauschii miR169c stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

1 open access papers mention ata-MIR169c
(1 sentences)

Stem-loop
   ---c    ucu   -        a     u      ----au    uu  a      cc        
5'     cucg   ggu agccaagg ugacu gccuau      gcuc  uc gaagcc  gguuauu 
       ||||   ||| |||||||| ||||| ||||||      ||||  || ||||||  |||||| c
3'     gagu   ccg ucgguucc acugg cggaua      ugag  ag cuuugg  ucgguac 
   cgac    ---   a        -     -      guaccu    -u  a      --        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
AOCO02032078.1: 15408894-15409010 [-]
intergenic
Database links

Mature sequence ata-miR169c-5p

Accession MIMAT0037136
Sequence

11 - 

uagccaaggaugacuugccua

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169c-3p

Accession MIMAT0037137
Sequence

90 - 

ggcggucaccuuggcuagc

 - 108

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).