Stem-loop sequence ata-MIR5200

AccessionMI0031672 (change log)
DescriptionAegilops tauschii miR5200 stem-loop
Gene family MIPF0001904; MIR5200
Stem-loop
   uuaag    a         u  a        cuag     u     uc 
5'      cacu aagccuuag ga uaucuaca    uaagu uuucu  a
        |||| ||||||||| || ||||||||    ||||| |||||  u
3'      gugg uucggaauc cu auagaugu    auucg aaagg  g
   uuaug    g         c  c        uacg     u     uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 61059186-61059284 [+]
intergenic
Database links

Mature sequence ata-miR5200-5p

Accession MIMAT0037138
Sequence

11 - 

aagccuuagugaauaucuaca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5200-3p

Accession MIMAT0037139
Sequence

69 - 

uguagauacucccuaaggcuu

 - 89

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).