Stem-loop sequence ata-MIR390

AccessionMI0031673 (change log)
DescriptionAegilops tauschii miR390 stem-loop
Gene family MIPF0000101; MIR390
Stem-loop
   ----------acaauccuugaagcucaggagggauagcgcc      uau  c     g      a   a    c 
5'                                          uagguu   ug aacca caagag ccg ccgg c
                                            ||||||   || ||||| |||||| ||| ||||  
3'                                          gucuag   ac uuggu guucuc ggc ggcc g
   uuguuuggcaccucgaguccuaucuaucgcgaagccugcuu      -cu  -     a      -   c    g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 417415781-417415919 [-]
intergenic
Database links

Mature sequence ata-miR390-5p

Accession MIMAT0037140
Sequence

11 - 

aagcucaggagggauagcgcc

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR390-3p

Accession MIMAT0037141
Sequence

110 - 

cgcuaucuauccugagcucc

 - 129

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).