Stem-loop sequence ata-MIR169j

AccessionMI0031674 (change log)
DescriptionAegilops tauschii miR169j stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

1 open access papers mention ata-MIR169j
(1 sentences)

Stem-loop
   ccauc    -a      a  a             a    c  uu   a   ga          
5'      uucg  uagcca gg ugauuugccugug aacu cc  ggc gcc  gcucucugc 
        ||||  |||||| || ||||||||||||| |||| ||  ||| |||  |||||||| c
3'      gagc  aucggu cc acugaacggguac uugg gg  cug cgg  cgagagaca 
   uccau    cc      c  -             c    c  -c   -   --          
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 446187527-446187645 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR169j
ata-MIR169achr5: 446192523-446192641 [-]
ata-MIR169jchr5: 446187527-446187645 [-]
Database links

Mature sequence ata-miR169j-5p

Accession MIMAT0037142
Sequence

11 - 

uagccaaggaugauuugccugug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169j-3p

Accession MIMAT0037143
Sequence

89 - 

ugggcaagucacccuggcuacc

 - 110

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).