Stem-loop sequence ata-MIR5181

AccessionMI0031675 (change log)
DescriptionAegilops tauschii miR5181 stem-loop
Gene family MIPF0001200; MIR5067
Literature search

1 open access papers mention ata-MIR5181
(1 sentences)

Stem-loop
   ---uuga   a      a                             a 
5'        acu ccuccg uccagaauaagugucgcaguuuugaacua c
          ||| |||||| ||||||||||||||||||||||||||||| g
3'        uga ggaggc agguuuuauucacagcgucaaaacuugau c
   uuuguaa   g      c                             c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 141170818-141170913 [+]
intergenic
Database links

Mature sequence ata-miR5181-5p

Accession MIMAT0037144
Sequence

11 - 

uccgauccagaauaagugucg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5181-3p

Accession MIMAT0037145
Sequence

66 - 

cacuuauuuuggaccggaggg

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).