Stem-loop sequence ata-MIR169b

AccessionMI0031676 (change log)
DescriptionAegilops tauschii miR169b stem-loop
Gene family MIPF0000012; MIR169_1
Literature search

1 open access papers mention ata-MIR169b
(1 sentences)

Stem-loop
   acau   c a      a                -    --ucc           
5'     cuu g uagcca ggaugauuugccugug aacc     cccgggagcc 
       ||| | |||||| |||||||||||||||| ||||     ||||||||| c
3'     gaa c aucggu ccuacugaacggguac uugg     gggcucucga 
   ccau   c c      -                c    uccaa           
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 446365443-446365545 [-]
intergenic
Database links

Mature sequence ata-miR169b-5p

Accession MIMAT0037146
Sequence

11 - 

uagccaaggaugauuugccugug

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169b-3p

Accession MIMAT0037147
Sequence

74 - 

ugggcaagucauccuggcuaccc

 - 96

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).