Stem-loop sequence ata-MIR395b

AccessionMI0031678 (change log)
DescriptionAegilops tauschii miR395b stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   --cuuacugcggguucccugcaaacacuucacgaagcauuauuucaaac   a   c a        -ga       u      ag      uccaagaacuaagaag 
5'                                                  gcc uug g aguguuug   ggaacuc ugguga  ucaagc                g
                                                    ||| ||| | ||||||||   ||||||| ||||||  ||||||                 
3'                                                  cgg agc c ucacgagc   ccuuggg gccauu  gguuug                u
   cguagugguucucaaggggguuugugaagugucaccauaaaccuuauua   -   a c        auc       u      cu      uacgaagcauaacuag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 522773862-522774075 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR395b
ata-MIR395cchr2: 522775061-522775197 [-]
ata-MIR395bchr2: 522773862-522774075 [-]
Database links

Mature sequence ata-miR395b-5p

Accession MIMAT0037150
Sequence

11 - 

guucccugcaaacacuucacg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395b-3p

Accession MIMAT0037151
Sequence

187 - 

aaguguuugggggaacuc

 - 204

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).