Stem-loop sequence ata-MIR160a

AccessionMI0031681 (change log)
DescriptionAegilops tauschii miR160a stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
   ----ca    ga     c       c         cu    -   cu      u  cca 
5'       augg  uaugc uggcucc uguaugcca  cgcg uag  gccaac cu   a
         ||||  ||||| ||||||| |||||||||  |||| |||  |||||| ||    
3'       ugcc  guacg accgagg gcgugcggu  gcgc auc  cgguug ga   a
   ucucuc    -a     a       a         ag    c   -u      c  ccc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 381892576-381892688 [-]
intergenic
Database links

Mature sequence ata-miR160a-5p

Accession MIMAT0037156
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR160a-3p

Accession MIMAT0037157
Sequence

61 - 

gcguuggcucuaccgcggaug

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).