Stem-loop sequence ata-MIR166d

AccessionMI0031682 (change log)
DescriptionAegilops tauschii miR166d stem-loop
Gene family MIPF0000004; MIR166
Literature search

1 open access papers mention ata-MIR166d
(1 sentences)

Stem-loop
   -c     -ga        uu      cu     -  - u -uu   uu      -    au    c  ---c c      cc  -        
5'   guuuu   ggggaaug  gucugg  cgggg cu c c   ucu  cucucu cucu  ccuc uc    c ucgacc  uc cuugauc 
     |||||   ||||||||  ||||||  ||||| || | |   |||  |||||| ||||  |||| ||    | ||||||  || |||||| a
3'   cagaa   ccccuuac  cggacc  gcucu ga g g   aga  gagaga gagg  ggag ag    g agcugg  ag gagcuag 
   aa     acc        uu      ag     a  u c ugc   -u      a    gg    u  ccua a      aa  a        
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 355440137-355440310 [-]
intergenic
Database links

Mature sequence ata-miR166d-5p

Accession MIMAT0037158
Sequence

11 - 

ggaauguugucuggcucgggg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR166d-3p

Accession MIMAT0037159
Sequence

144 - 

ucggaccaggcuucauucccc

 - 164

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).