Stem-loop sequence ata-MIR395a

AccessionMI0031684 (change log)
DescriptionAegilops tauschii miR395a stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   --cu  u            u               -  a   u 
5'     cg cgggaguucccu caagcacuucaggaa gc ucu u
       || |||||||||||| ||||||||||||||| || ||| u
3'     gu guucucaagggg guuugugaagucuuu cg gga g
   cacu  u            -               a  -   u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 456759238-456759321 [-]
intergenic
Database links

Mature sequence ata-miR395a-5p

Accession MIMAT0037162
Sequence

11 - 

guucccuucaagcacuucagg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395a-3p

Accession MIMAT0037163
Sequence

55 - 

ugaaguguuugggggaacuc

 - 74

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).