Stem-loop sequence ata-MIR395d

AccessionMI0031685 (change log)
DescriptionAegilops tauschii miR395d stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   guau               u             aacua   uuuu     auua             --     c   ug   ca       acuuaaaagauauugcaagucaua 
5'     uacugggaguucccu caagcacuuuacg     cuu    aaggu    ugugaaguguuug  gggaa ucu  gug  acuaagc                        a
       ||||||||||||||| |||||||||||||     |||    |||||    |||||||||||||  ||||| |||  |||  |||||||                        a
3'     guggcucucaagggg guuugugaagugu     gga    uucca    gcauuucacaaac  uccuu agg  cac  ugguuug                        c
   caau               -             acucg   cucu     cuag             uu     a   gu   ua       cccuaaacgucauguagagcacac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 522785958-522786189 [-]
intergenic
Database links

Mature sequence ata-miR395d-5p

Accession MIMAT0037164
Sequence

12 - 

aguucccuucaagcacuuuacg

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395d-3p

Accession MIMAT0037165
Sequence

203 - 

ugaaguguuugggggaacuc

 - 222

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).