Stem-loop sequence ata-MIR396c

AccessionMI0031688 (change log)
DescriptionAegilops tauschii miR396c stem-loop
Gene family MIPF0000047; MIR396
Literature search

1 open access papers mention ata-MIR396c
(1 sentences)

Stem-loop
   --      gc                   a     -     ---g   -     -uaa  a      ac  ucuc        c  u  ucu 
5'   ugccau  cuuuccacagcuuucuuga cuucu cuugc    ccu cuccu    uu cucccc  uc    ugucucuc cu uc   c
     ||||||  ||||||||||||||||||| ||||| |||||    ||| |||||    || ||||||  ||    |||||||| || ||    
3'   acggua  gaagggugucgaaagaacu ggaga gaacg    gga gagga    ag gagggg  ag    acagagag ga gg   c
   au      aa                   g     a     acga   c     caag  a      ca  ---u        a  u  uug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 353404393-353404567 [-]
intergenic
Database links

Mature sequence ata-miR396c-5p

Accession MIMAT0037170
Sequence

11 - 

uuccacagcuuucuugaacuu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR396c-3p

Accession MIMAT0037171
Sequence

145 - 

ggucaagaaagcugugggaag

 - 165

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).