Stem-loop sequence ata-MIR6201

AccessionMI0031689 (change log)
DescriptionAegilops tauschii miR6201 stem-loop
Gene family MIPF0001960; MIR6201
Stem-loop
   -  c   c     a             a      cggcugguuuagaaugcuagcc 
5'  ca cgg guuug cccugaggcacuc uaccgc                      c
    || ||| ||||| ||||||||||||| ||||||                       
3'  gu gcc caaac gggacucugugag auggcg                      g
   a  a   u     c             c      aucguaagauuuccgugaguau 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 369820159-369820271 [+]
intergenic
Database links

Mature sequence ata-miR6201-5p

Accession MIMAT0037172
Sequence

11 - 

ugacccugaggcacucauaccg

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR6201-3p

Accession MIMAT0037173
Sequence

83 - 

guacgagugucucagggccaa

 - 103

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).