Stem-loop sequence ata-MIR167b

AccessionMI0031690 (change log)
DescriptionAegilops tauschii miR167b stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

1 open access papers mention ata-MIR167b
(12 sentences)

Stem-loop
   --c  a   u         g               -   cuaacuc      c 
5'    ac agc ggugaagcu ccagcaugaucugau gac       auggau a
      || ||| ||||||||| ||||||||||||||| |||       ||||||  
3'    ug ucg cuacuuuga ggucguacuggacua cug       uaccua g
   ggc  g   u         -               a   -------      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 62966137-62966233 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR167b
ata-MIR167cchr5: 62968615-62968710 [-]
ata-MIR167bchr5: 62966137-62966233 [-]
Database links

Mature sequence ata-miR167b-5p

Accession MIMAT0037174
Sequence

11 - 

ugaagcugccagcaugaucuga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR167b-3p

Accession MIMAT0037175
Sequence

67 - 

aggucaugcuggaguuucauc

 - 87

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).