Stem-loop sequence ata-MIR398f

AccessionMI0031691 (change log)
DescriptionAegilops tauschii miR398f stem-loop
Gene family MIPF0000107; MIR398
Stem-loop
   c    aagu   u  a   u   a               auaua   a 
5'  gagg    ucc gc ggg cga cugagaacacaugag     uug c
    ||||    ||| || ||| ||| |||||||||||||||     ||| g
3'  cucc    agg cg ccc gcu gacucuuguguacuc     agc a
   -    ---g   u  c   c   g               -aauc   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 426489965-426490058 [-]
intergenic
Database links

Mature sequence ata-miR398f-5p

Accession MIMAT0037176
Sequence

17 - 

gggucgaacugagaacacaug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR398f-3p

Accession MIMAT0037177
Sequence

64 - 

uguguucucaggucgcccccg

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).