Stem-loop sequence ata-MIR169f

AccessionMI0031692 (change log)
DescriptionAegilops tauschii miR169f stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

1 open access papers mention ata-MIR169f
(1 sentences)

Stem-loop
   -   ug aa  c           -        a  --------  a   aa 
5'  gag  g  ug agccaaggaug acuugccg ca        gc cac  c
    |||  |  || ||||||||||| |||||||| ||        || |||   
3'  cuc  u  ac ucgguuccugc ugaacggc gu        ug gug  a
   u   gu cc  a           c        c  ucuaauga  -   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ata-miR169f-5p

Accession MIMAT0037178
Sequence

11 - 

cagccaaggaugacuugccga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169f-3p

Accession MIMAT0037179
Sequence

63 - 

ggcaaguccguccuuggcuaca

 - 84

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).