Stem-loop sequence ata-MIR2118a

AccessionMI0031693 (change log)
DescriptionAegilops tauschii miR2118a stem-loop
Gene family MIPF0000745; MIR2118
Literature search

1 open access papers mention ata-MIR2118a
(1 sentences)

Stem-loop
   -    u u c      -a    c            g     ug   a   ----          - uu  c   ugugcaauagauuaauucauaaaccauaaaua 
5'  guug g g uuuccu  augu ucccauuccuau guucu  agc cuc    cuuccucuuc c  uu gcu                                u
    |||| | | ||||||  |||| |||||||||||| |||||  ||| |||    |||||||||| |  || |||                                g
3'  caau c c aaagga  uaca aggguaagggug cgaga  ucg gag    gaaggagaag g  ga cgg                                u
   u    c - -      gg    -            a     gu   a   aaaa          a cu  u   aagaucuagaguccaauagauccauacacgug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 441278647-441278851 [+]
intergenic
Database links

Mature sequence ata-miR2118a-5p

Accession MIMAT0037180
Sequence

11 - 

uuccuaaugucucccauuccua

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR2118a-3p

Accession MIMAT0037181
Sequence

176 - 

gggaaugggaacauggaggaa

 - 196

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).