Stem-loop sequence ata-MIR5062a

AccessionMI0031696 (change log)
DescriptionAegilops tauschii miR5062a stem-loop
Gene family MIPF0001922; MIR5062
Stem-loop
   c      u      c   a  -      -      a  ac   u    u        cuuaucuuaucccagaacugcuc 
5'  guagcu cuugaa cuu gg gaaaag ccgcau ac  cau aacu gaaaacca                       c
    |||||| |||||| ||| || |||||| |||||| ||  ||| |||| ||||||||                        
3'  uauugg gaacuu gaa cc cuuuuu ggugua ug  gug uuga uuuuuggu                       u
   c      u      a   -  a      a      c  ga   u    -        aaaaaauggggaauauaacacca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 421456466-421456623 [+]
intergenic
Database links

Mature sequence ata-miR5062a-5p

Accession MIMAT0037186
Sequence

11 - 

ugaaccuuagggaaaagccgcau

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5062a-3p

Accession MIMAT0037187
Sequence

127 - 

guggauuuuucaccaagauucaag

 - 150

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).