Stem-loop sequence ata-MIR408

AccessionMI0031697 (change log)
DescriptionAegilops tauschii miR408 stem-loop
Gene family MIPF0000102; MIR408
Stem-loop
   a   c  a    a      u ga    a   a    u       a      acuu    ugcuuccuuccacugaucaccuccugauuauaugaca 
5'  ggg ag ggag caggga g  gcag gca ggga ggggcaa caacaa    caac                                     a
    ||| || |||| |||||| |  |||| ||| |||| ||||||| ||||||    ||||                                      
3'  ccc uc ccuc gucccu c  cguc cgu cccu ccucguu guuguu    guug                                     g
   a   -  c    c      u uc    a   -    c       -      ----    uuauuguuuucgagaguagagaguguugagagagcga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 421297003-421297189 [-]
intergenic
Database links

Mature sequence ata-miR408-5p

Accession MIMAT0037188
Sequence

14 - 

cagggauggagcagagcaagg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR408-3p

Accession MIMAT0037189
Sequence

158 - 

ugcacugccucuucccugcc

 - 177

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).