Stem-loop sequence ata-MIR171a

AccessionMI0031698 (change log)
DescriptionAegilops tauschii miR171a stem-loop
Gene family MIPF0000104; MIR171_2
Stem-loop
   --  cg     -c        u             c     ga  a 
5'   ga  acaug  ugguauug uucggcucauguc ucguc  gc c
     ||  |||||  |||||||| ||||||||||||| |||||  || a
3'   cu  uguac  acuauaac aagccgaguguag aguag  ug u
   uu  ua     uc        c             -     gc  c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 424680735-424680825 [-]
intergenic
Database links

Mature sequence ata-miR171a-5p

Accession MIMAT0037190
Sequence

11 - 

ugguauuguuucggcucaug

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR171a-3p

Accession MIMAT0037191
Sequence

61 - 

ugagccgaaccaauaucacuc

 - 81

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).