Stem-loop sequence ata-MIR528

AccessionMI0031699 (change log)
DescriptionAegilops tauschii miR528 stem-loop
Gene family MIPF0000868; MIR528
Stem-loop
   --  a    cg            u   g     c -  -cau   ccau  -      
5'   gc gcag  guggaaggggca gca aggag g gc    ggc    gg gagcu 
     || ||||  |||||||||||| ||| ||||| | ||    |||    || |||| u
3'   cg cguc  uaccuucuccgu cgu uccuc c cg    ccg    cc uucgu 
   au  g    cu            c   g     u u  cucu   --uu  g      
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 384368280-384368387 [+]
intergenic
Database links

Mature sequence ata-miR528-5p

Accession MIMAT0037192
Sequence

11 - 

uggaaggggcaugcagaggag

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR528-3p

Accession MIMAT0037193
Sequence

78 - 

ccugugccugccucuuccauu

 - 98

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).