Stem-loop sequence ata-MIR167f

AccessionMI0031701 (change log)
DescriptionAegilops tauschii miR167f stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

1 open access papers mention ata-MIR167f
(12 sentences)

Stem-loop
   -u        c         c           cucauccagcaugcgccgaaaccgcguucgg 
5'   gugagaga ugaagcugc agcaugaucug                               u
     |||||||| ||||||||| |||||||||||                                
3'   cacucuuu acuucgacg ucguacuagac                               u
   gg        u         -           uaccucguuuuuaagguucuauuggggcgcg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 134463342-134463467 [-]
intergenic
Database links

Mature sequence ata-miR167f-5p

Accession MIMAT0037196
Sequence

11 - 

ugaagcugccagcaugaucugc

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR167f-3p

Accession MIMAT0037197
Sequence

96 - 

cagaucaugcugcagcuucau

 - 116

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).