Stem-loop sequence ata-MIR160c

AccessionMI0031703 (change log)
DescriptionAegilops tauschii miR160c stem-loop
Gene family MIPF0000032; MIR160
Stem-loop
   ----c    uu      c       c              -   gc    cc     
5'      gugc  gugugc uggcucc uguaugccacucau gua  ccaa  cgcg 
        ||||  |||||| ||||||| |||||||||||||| |||  ||||  ||| g
3'      caug  cguacg accgagg acgugcggugggug cgu  gguu  gugc 
   acaua    --      a       a              u   -a    -a     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 416809197-416809300 [+]
intergenic
Database links

Mature sequence ata-miR160c-5p

Accession MIMAT0037200
Sequence

11 - 

ugccuggcucccuguaugcca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR160c-3p

Accession MIMAT0037201
Sequence

74 - 

gcgugcaaggagccaagcaug

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).