Stem-loop sequence ata-MIR5062b

AccessionMI0031704 (change log)
DescriptionAegilops tauschii miR5062b stem-loop
Gene family MIPF0001922; MIR5062
Stem-loop
   --   ag  c      a      a  -   a      u      c        uugacuuaagugcuccuaccacaauguaccuagcguuuuauuacccauguuuuuuuauuau 
5'   gug  gu augcgg uuuuuc cc aag uucaag gguuau uggaucuu                                                             c
     |||  || |||||| |||||| || ||| |||||| |||||| ||||||||                                                             a
3'   uac  ca uacgcc gaaaag gg uuc aaguuc ucgaug acuuggaa                                                             u
   au   ca  a      -      -  a   c      u      c        ugaacaauguacguuaggucacugguguauauugaacguguauuaacguggguccauguua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ata-miR5062b-5p

Accession MIMAT0037202
Sequence

11 - 

gcggauuuuucaccaagauucaag

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR5062b-3p

Accession MIMAT0037203
Sequence

194 - 

ugaaccuuagggaaaagccgcau

 - 216

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).