Stem-loop sequence ata-MIR169d

AccessionMI0031706 (change log)
DescriptionAegilops tauschii miR169d stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

1 open access papers mention ata-MIR169d
(1 sentences)

Stem-loop
   --    -   a  c         ug           -- -    u   g  ag 
5'   gaac ggg ug agccaagga  acuugccggcu  c cugg guu gg  u
     |||| ||| || |||||||||  |||||||||||  | |||| ||| ||   
3'   cuug ucc ac ucgguuccu  ugaacggccga  g gauu cga uc  u
   cu    a   -  a         gu           uu a    u   g  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 452086951-452087051 [+]
intergenic
Clustered miRNAs
< 10kb from ata-MIR169d
ata-MIR169dchr2: 452086951-452087051 [+]
ata-MIR169echr2: 452091058-452091150 [+]
Database links

Mature sequence ata-miR169d-5p

Accession MIMAT0037206
Sequence

11 - 

cagccaaggaugacuugccgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169d-3p

Accession MIMAT0037207
Sequence

71 - 

ggcaaguuguccuuggcuaca

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).