Stem-loop sequence ata-MIR395c

AccessionMI0031708 (change log)
DescriptionAegilops tauschii miR395c stem-loop
Gene family MIPF0000016; MIR395
Stem-loop
   --      ug         u    u       -au   ua    augc  a   g     u  -     gu 
5'   gucacc  gaguucucc caaa cacuuca   ugc  gcuu    cu auu uugca ug gcacu  u
     ||||||  ||||||||| |||| |||||||   |||  ||||    || ||| ||||| || |||||  u
3'   cggugg  cucaagggg guuu gugaagu   acg  cgga    ga uag gacgu ac uguga  u
   aa      gu         -    -       gau   ug    --ga  a   g     u  g     aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 522775061-522775197 [-]
intergenic
Clustered miRNAs
< 10kb from ata-MIR395c
ata-MIR395cchr2: 522775061-522775197 [-]
ata-MIR395bchr2: 522773862-522774075 [-]
Database links

Mature sequence ata-miR395c-5p

Accession MIMAT0037210
Sequence

11 - 

guucuccucaaaucacuuca

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR395c-3p

Accession MIMAT0037211
Sequence

108 - 

ugaaguguuugggggaacuc

 - 127

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).