Stem-loop sequence ata-MIR164a

AccessionMI0031709 (change log)
DescriptionAegilops tauschii miR164a stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
   -c   - g            c  g         -     - aucg 
5'   gaa c gugcuggagaag ag gcacgugcu cgauc c    a
     ||| | |||||||||||| || ||||||||| ||||| |    c
3'   cuu g uacgaccucuuc uc cgugcacga guugg g    c
   cu   c g            c  g         c     c aaac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr6: 334256766-334256854 [-]
intergenic
Database links

Mature sequence ata-miR164a-5p

Accession MIMAT0037212
Sequence

11 - 

uggagaagcagggcacgugcu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR164a-3p

Accession MIMAT0037213
Sequence

59 - 

cacgugcgcuccuucuccagc

 - 79

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).