Stem-loop sequence ata-MIR1432

AccessionMI0031710 (change log)
DescriptionAegilops tauschii miR1432 stem-loop
Gene family MIPF0001063; MIR1432
Stem-loop
   -         a     a   a          g    u         ---c     a 
5'  gguccugug ucagg gag ugacaccgac ccga cagaugggu    ggcuu a
    ||||||||| ||||| ||| |||||||||| |||| |||||||||    |||||  
3'  ucgggauac agucc cuc acugugguug ggcu gucugccua    ccgga c
   c         a     g   c          a    u         cgua     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr2: 150649281-150649390 [+]
intergenic
Database links

Mature sequence ata-miR1432-5p

Accession MIMAT0037214
Sequence

11 - 

ucaggagagaugacaccgacg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR1432-3p

Accession MIMAT0037215
Sequence

81 - 

uuggugucaccucgccugaac

 - 101

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).