Stem-loop sequence ata-MIR9776

AccessionMI0031711 (change log)
DescriptionAegilops tauschii miR9776 stem-loop
Gene family MIPF0001990; MIR9776
Stem-loop
   agc             a         a    -   acg    gac 
5'    uagagcuuggacg ggaugugca cugc ggu   guag   c
      ||||||||||||| ||||||||| |||| |||   ||||   u
3'    aucucgaaccugu ccuacacgu gacg cca   cauc   u
   ---             a         c    g   --g    gac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 390626058-390626144 [+]
intergenic
Database links

Mature sequence ata-miR9776-5p

Accession MIMAT0037216
Sequence

7 - 

agcuuggacgaggaugugcaa

 - 27

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9776-3p

Accession MIMAT0037217
Sequence

66 - 

gcacauccauguccaagcucu

 - 86

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).