Stem-loop sequence ata-MIR164b

AccessionMI0031712 (change log)
DescriptionAegilops tauschii miR164b stem-loop
Gene family MIPF0000045; MIR164
Stem-loop
   ---- c    ga          c             u   uucca  u    uc      uc       --cu   u       acc   cc  c 
5'     g gcgc  gguggagaag agggcacgugcau cau     gc cggu  ccggcg  cggccgg    ggc ggcacgc   gcc  gg c
       | ||||  |||||||||| ||||||||||||| |||     || ||||  ||||||  |||||||    ||| |||||||   |||  || u
3'     c cgug  ccaccucuuc uuccguguacgua gua     cg gccg  ggccgc  gccggcc    ucg cugugug   cgg  cc u
   ucca a    --          u             c   ---cc  -    gc      gu       uagc   -       -au   -u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr1: 396523233-396523410 [+]
intergenic
Database links

Mature sequence ata-miR164b-5p

Accession MIMAT0037218
Sequence

11 - 

uggagaagcagggcacgugca

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR164b-3p

Accession MIMAT0037219
Sequence

148 - 

caugugccuuucuucuccacc

 - 168

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).