Stem-loop sequence ata-MIR172c

AccessionMI0031714 (change log)
DescriptionAegilops tauschii miR172c stem-loop
Gene family MIPF0000035; MIR172
Literature search

1 open access papers mention ata-MIR172c
(2 sentences)

Stem-loop
   --    u      ug               a    --au   ---    ----au   u    u    -   -   u   cca          c   u    u 
5'   gauu cuggug  gcaucaucaagauuc caca    gua   uggc      gca gcga gcuc uca ucc ucc   uccaugcaug aug gaac g
     |||| ||||||  ||||||||||||||| ||||    |||   ||||      ||| |||| |||| ||| ||| |||   |||||||||| ||| ||||  
3'   cuag ggcuac  cguaguaguucuaag gugu    cau   accg      cgu cguu cgag agu agg agg   agguacguac ugc cuug u
   aa    u      gu               g    guau   gcg    aucgcu   u    -    u   u   u   uag          u   -    a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 512073407-512073599 [-]
intergenic
Database links

Mature sequence ata-miR172c-5p

Accession MIMAT0037222
Sequence

11 - 

guggcaucaucaagauucacaca

 - 33

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR172c-3p

Accession MIMAT0037223
Sequence

163 - 

ggaaucuugaugaugcugcau

 - 183

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).