Stem-loop sequence ata-MIR9677

AccessionMI0031715 (change log)
DescriptionAegilops tauschii miR9677 stem-loop
Gene family MIPF0001925; MIR9677
Stem-loop
   g   uc    c     c           a        uccccc 
5'  gcc  gcuu ucuuc acucuaccaac gccacguc      g
    |||  |||| ||||| ||||||||||| ||||||||       
3'  cgg  cgag agagg ugagaugguug cggugcgg      c
   -   ua    c     a           c        uaccag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 109677717-109677803 [-]
intergenic
Database links

Mature sequence ata-miR9677-5p

Accession MIMAT0037224
Sequence

14 - 

uuccacucuaccaacagccacg

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9677-3p

Accession MIMAT0037225
Sequence

56 - 

uggccguugguagaguaggaga

 - 77

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).