Stem-loop sequence ata-MIR2275c

AccessionMI0031716 (change log)
DescriptionAegilops tauschii miR2275c stem-loop
Gene family MIPF0000797; MIR2275
Stem-loop
   g   a    uu    -       u gg          ac    g g      --             c     u            uaugucagacgcuggguguuagcuacaagccuacaacaagugau 
5'  cag ugaa  ugag uguugga g  accaaaucuu  ugcc g uguggc  aagauuugguuuc uccaa aucuuauguuca                                            a
    ||| ||||  |||| ||||||| |  ||||||||||  |||| | ||||||  ||||||||||||| ||||| ||||||||||||                                            g
3'  guc acuu  acuc auaaccu c  ugguuuagaa  acgg u auaucg  uucuaaaccaagg agguu uagaguguaagu                                            u
   -   a    cu    u       c uu          -c    - g      ac             u     -            cgaacgcuccaauccaagaacucuguccggguccacagguaggu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 117539141-117539396 [-]
intergenic
Database links

Mature sequence ata-miR2275c-5p

Accession MIMAT0037226
Sequence

14 - 

aguguuggaugggaccaaauc

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR2275c-3p

Accession MIMAT0037227
Sequence

225 - 

uuugguuuccuccaauaucuca

 - 246

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).