Stem-loop sequence ata-MIR171d

AccessionMI0031717 (change log)
DescriptionAegilops tauschii miR171d stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   --       u         u  a    c     -    gccggccggccggc 
5'   gucacua gauguuggc cg cuca ucaga ccac              c
     ||||||| ||||||||| || |||| ||||| ||||              g
3'   uagugau cuauaaccg gc gagu agucu ggug              g
   uc       u         u  c    u     u    gcggcgccuaccga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 388577366-388577469 [+]
intergenic
Database links

Mature sequence ata-miR171d-5p

Accession MIMAT0037228
Sequence

11 - 

uguuggcucgacucacucaga

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR171d-3p

Accession MIMAT0037229
Sequence

74 - 

ugauugagccgugccaauauc

 - 94

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).