Stem-loop sequence ata-MIR398g

AccessionMI0031718 (change log)
DescriptionAegilops tauschii miR398g stem-loop
Gene family MIPF0000107; MIR398
Stem-loop
   c    aaau   u      u   g              ---    u  ac      a 
5'  gagg    ucc gugggg cga cugggaacacauga   gaua ga  cgcuug u
    ||||    ||| |||||| ||| ||||||||||||||   |||| ||  |||||| u
3'  cucc    agg cgcccc gcu gacucuuguguacu   cuau cu  gcgagc g
   -    ---g   u      c   g              caa    u  cu      a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 426371670-426371779 [-]
intergenic
Database links

Mature sequence ata-miR398g-5p

Accession MIMAT0037230
Sequence

17 - 

gggucgagcugggaacacaug

 - 37

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR398g-3p

Accession MIMAT0037231
Sequence

80 - 

uguguucucaggucgcccccg

 - 100

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).