Stem-loop sequence ata-MIR167d

AccessionMI0031719 (change log)
DescriptionAegilops tauschii miR167d stem-loop
Gene family MIPF0000023; MIR167_1
Literature search

1 open access papers mention ata-MIR167d
(12 sentences)

Stem-loop
   -  ca  u              g          aa  u         g    ---- ug          uc 
5'  ca  ag agaugaagcugcca caugaucuga  gc agcuauguu caug    u  aucuugaugg  a
    ||  || |||||||||||||| ||||||||||  || ||||||||| ||||    |  ||||||||||   
3'  gu  uc uuuacuucgacggu guacuggacu  cg ucgguacgg guac    a  uagaacuacc  u
   g  ac  u              -          aa  -         -    caga gu          uc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 348738068-348738203 [+]
intergenic
Database links

Mature sequence ata-miR167d-5p

Accession MIMAT0037232
Sequence

11 - 

ugaagcugccagcaugaucuga

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR167d-3p

Accession MIMAT0037233
Sequence

107 - 

aggucauguggcagcuucauu

 - 127

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).