Stem-loop sequence ata-MIR394

AccessionMI0031720 (change log)
DescriptionAegilops tauschii miR394 stem-loop
Gene family MIPF0000100; MIR394
Stem-loop
   --cg g      -      u c           uu ug au        ---- g     u 
5'     a agcucu uuggca u uguccaccucc  g  a  cuugcagg    g agauc c
       | |||||| |||||| | |||||||||||  |  |  ||||||||    | |||||  
3'     u ucgagg aaccgu a acggguggagg  c  u  gggcguuc    u ucuag a
   gaug g      u      c u           uu gu --        gagc g     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
AOCO02001108.1: 10953161-10953275 [+]
intergenic
Database links

Mature sequence ata-miR394-5p

Accession MIMAT0037234
Sequence

11 - 

uuggcauucuguccaccucc

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR394-3p

Accession MIMAT0037235
Sequence

85 - 

aggugggcauacugccaaugg

 - 105

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).