Stem-loop sequence ata-MIR156e

AccessionMI0031722 (change log)
DescriptionAegilops tauschii miR156e stem-loop
Gene family MIPF0000008; MIR156
Literature search

1 open access papers mention ata-MIR156e
(37 sentences)

Stem-loop
   -ugc  au -         -    a        a         a  a      guaaagagga  gau 
5'     ga  g gcugacaga agag gugagcac cagcggcag cu cgucug          cg   g
       ||  | ||||||||| |||| |||||||| ||||||||| || ||||||          ||    
3'     cu  c cgacugucu ucuc cacucgug guugucguc ga gcagau          gc   g
   gccu  cu u         c    c        c         -  c      agagagagaa  gua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr5: 232754845-232754978 [-]
intergenic
Database links

Mature sequence ata-miR156e-5p

Accession MIMAT0037238
Sequence

11 - 

ugacagaagagagugagcac

 - 30

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR156e-3p

Accession MIMAT0037239
Sequence

104 - 

gcucacccucucucugucagc

 - 124

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).