Stem-loop sequence ata-MIR319

AccessionMI0031725 (change log)
DescriptionAegilops tauschii miR319 stem-loop
Gene family MIPF0000010; MIR159
Literature search

1 open access papers mention ata-MIR319
(1 sentences)

Stem-loop
   u    -- ug  a    u            cu u     gg u  a     --u        g   au       u  ac         accaag     
5'  cugu  g  ag gagc cucuucagucca  c cagau  u gu ggguu   uauuagcu ccg  ucauuca uc  cuaccaaga      gcgg 
    ||||  |  || |||| ||||||||||||  | |||||  | || |||||   |||||||| |||  ||||||| ||  |||||||||      ||| a
3'  gacg  c  uc cucg gggaagucaggu  g guuug  g ca cucga   auaaucga ggc  aguaggu ag  gaugguucu      cgcg 
   u    cu gu  c    u            ug u     uu -  g     uuu        g   gc       c  cc         ---gua     
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr3: 198091819-198092009 [-]
intergenic
Database links

Mature sequence ata-miR319-5p

Accession MIMAT0037244
Sequence

55 - 

agcugccgauucauucauuca

 - 75

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR319-3p

Accession MIMAT0037245
Sequence

116 - 

acuggaugacgcgggagcuaa

 - 136

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).