Stem-loop sequence ata-MIR171b

AccessionMI0031728 (change log)
DescriptionAegilops tauschii miR171b stem-loop
Gene family MIPF0000030; MIR171_1
Stem-loop
   -    ag c                      a       gggc        agg g 
5'  ggag  u cgauguuggcauggcucaauca aucgagu    ggcgaucg   c u
    ||||  | |||||||||||||||||||||| |||||||    ||||||||   | g
3'  ccuc  a gcuauaaccgugccgaguuagu uagcuca    uuguuagu   g a
   u    ga c                      c       --au        aua a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 39471666-39471777 [+]
intergenic
Database links

Mature sequence ata-miR171b-5p

Accession MIMAT0037250
Sequence

12 - 

uguuggcauggcucaaucaaa

 - 32

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR171b-3p

Accession MIMAT0037251
Sequence

82 - 

ugauugagccgugccaauauc

 - 102

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).