Stem-loop sequence ata-MIR169h

AccessionMI0031729 (change log)
DescriptionAegilops tauschii miR169h stem-loop
Gene family MIPF0000037; MIR169_2
Literature search

1 open access papers mention ata-MIR169h
(1 sentences)

Stem-loop
   -     ga    -         ug          -u    g  u     -c    u   g    ua 
5'  gggca  augu agccaagga  acuugccggg  augu ca guaug  uuca ggu aggg  u
    |||||  |||| |||||||||  ||||||||||  |||| || |||||  |||| ||| ||||  g
3'  ccugu  uacg ucgguucuu  ugaacggccu  uaua gu cguac  aagu ucg uccc  c
   u     uc    a         gu          uu    -  -     cu    u   -    ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr7: 430309495-430309622 [-]
intergenic
Database links

Mature sequence ata-miR169h-5p

Accession MIMAT0037252
Sequence

11 - 

uagccaaggaugacuugccgg

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR169h-3p

Accession MIMAT0037253
Sequence

99 - 

gcaaguuguucuuggcuagc

 - 118

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).