Stem-loop sequence ata-MIR9674b

AccessionMI0031731 (change log)
DescriptionAegilops tauschii miR9674b stem-loop
Gene family MIPF0001917; MIR9674
   ggcggcugcugcugccccacgauggguaggaug  c              c    acccgauguucgugccacaccgcguccgu 
5'                                  gc ggugcuauggauag uuca                             c
                                    || |||||||||||||| ||||                              
3'                                  cg cuacgauaccuguu aagu                             g
   ------------------------ugccggcca  a              u    cggucuccuaaccgagggacgaacugagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (ASM34733v2; GCA_000347335.2) Overlapping transcripts
chr4: 409005913-409006058 [-]
Database links

Mature sequence ata-miR9674b-5p

Accession MIMAT0037256

37 - 


 - 57

Get sequence
Evidence experimental; Illumina [1]

Mature sequence ata-miR9674b-3p

Accession MIMAT0037257

116 - 


 - 136

Get sequence
Evidence experimental; Illumina [1]


PMID:23535592 "Aegilops tauschii draft genome sequence reveals a gene repertoire for wheat adaptation" Jia J, Zhao S, Kong X, Li Y, Zhao G, He W, Appels R, Pfeifer M, Tao Y, Zhang X, Jing R, Zhang C, Ma Y, Gao L, Gao C, Spannagl M, Mayer KF, Li D, Pan S, Zheng F, Hu Q, Xia X, Li J, Liang Q, Chen J, Wicker T, Gou C, Kuang H, He G, Luo Y, Keller B, Xia Q, Lu Nature. 496:91-95(2013).